CUENTOS DE CANTERBURY (En PDF)

Chaucer comenzó a escribir los Cuentos de Canterbury durante la década de 1380, pero lo abandonó a finales de la década siguiente. Es probable que Chaucer no tuviera una estructura fijada al escribir la obra, pues esta parece haber sido revisada varias veces, al serle añadidos nuevos cuentos. En el prólogo general, el anfitrión, Harry Bailly, anuncia 120 cuentos (cuatro cada uno, dos en la ida a Canterbury y dos en la vuelta a la taberna). Sin embargo, el resultado final son 24 cuentos, todos ellos en el viaje de ida. Se ha sugerido que el dejar el final inacabado fue una acción deliberada por parte de Chaucer. Otros estudiosos señalan que es posible que la muerte sorprendiera a Chaucer —se supone que este muere hacia 1400— y que de esta manera la obra quedara inconclusa.

La estructura de «cuentos contenidos» de Los cuentos de Canterbury es fácil de encontrar en otras obras de la época, como el Libro de buen amor del Arcipreste de Hita, el Conde Lucanor de don Juan Manuel o el Decamerón de Boccaccio, el cual puede haber sido la principal fuente de inspiración para Chaucer. De hecho, éste adaptó varias de las historias de Boccaccio poniéndolas en boca de sus peregrinos. Sin embargo, lo que separa a Chaucer de sus contemporáneos es la caracterización de sus personajes.

Comparando con los narradores de El Decamerón (siete mujeres y tres hombres, todos jóvenes y acomodados, de nombres clásicos), los personajes de Chaucer son más variados y representan prácticamente todas las variantes de la sociedad de la época. Los relatos, además, son también de diferentes tipos, lo que permite mostrar las distintas personalidades a través de sus selecciones narrativas y su forma de contarlas.

 

En cuanto a la peregrinación en sí misma, no parece ser más que un recurso literario para juntar a tan diverso grupo. Por ejemplo, un monje raramente obtendría permiso para realizar la peregrinación, y en el caso de algunos otros personajes, resulta difícil de creer el simple deseo de acudir. Por otro lado, todos los peregrinos viajan a caballo, por lo que no podemos pensar que haya ningún tipo de penitencia. Tampoco se menciona ninguna visita a los santuarios del camino o de la celebración de la misa, de modo que la peregrinación tiene más apariencia de un viaje turístico.

Chaucer tampoco presta mucha atención al avance realizado durante el viaje y, aunque apunta a que los cuentos son narrados en varios días, no detalla ninguna de las paradas del grupo para dormir. Aunque el viaje podía realizarse en solo un día, esto sería un tiempo demasiado corto para la correcta narración de los cuentos y habitualmente, este tipo de viajes tenían una duración de dos o tres días. Concretamente se menciona el 18 de abril en los Cuentos y Walter William Skeat, editor y crítico de la obra en el siglo XIX, determinó el 17 de abril de 1387 como el primer día de narración de los cuentos.

Los académicos dividen el cuento en diez fragmentos. Entre ellos, todos los que componen un fragmento están conectados de forma directa, frecuentemente porque un personaje pasa el turno de palabra a otro, pero no hay ninguna introducción entre los fragmentos. Esto significa que no existe un orden o cronología fija en los fragmentos, y por lo tanto tampoco en los cuentos.

Aquí para descargar o visualizar

CUENTOS DE CANTERBURY (En PDF)

CONCLUSIONES SOBRE EL CORONAVIRUS. RECAPITULACIÓN (PARTE 7).Y fin de la serie.

Queridos amigos. Queridas amigas. Han sido dos intensas semanas hablando monográficamente de la ciencia en general y del coronavirus en particular. En seis artículos y una Carta Abierta he intentado poner un poco de orden en este caos. Tarea tal vez inútil. O no. Nunca se sabe. Pero uno no deja de ser médico por salir de la consulta, y me gusta la educación para la salud como parte de mi especialidad: la medicina de familia.

Sé que los Seres de Luz no tienen luces. Y no la tendrían ni en el Siglo de las Luces, que fue el XVIII (18 para las víctimas de la E.S.O.). Pero qué le vamos a hacer. Con dos o tres que se hayan replanteado sus errores, me daré por satisfecho.

Al resto de lectores, muchísimas gracias. Ha sido una cosa impresionante. Más de 100.000 reproducciones directas desde mi muro, invitaciones de la televisión vasca y de Antena 3 TV para entrar en directo con Susana Griso (que he rechazado), invitaciones de cadenas de radio nacionales y extranjeras (que he rechazado), e invitaciones de muchísimos periodistas para hacerme una entrevista (que he rechazado). No quiero más protagonismo que el de mi propio muro de Facebook. Para mí, es suficiente.

Quiero agradecer muy especialmente a médicos, enfermeras, auxiliares, celadores, psicólogos, biólogos, investigadores, odontólogos, TER, fisioterapeutas, farmacéuticos, forenses y veterinarios que han respondido en mi muro a cuestiones relacionadas con la ciencia o con las tareas sanitarias. Sois siempre bienvenidos.

Y una mención emocionada a nuestros hermanos de Chile, Argentina, Uruguay, Venezuela, Bolivia, Colombia, Puerto Rico, Cuba, Costa Rica, República Dominicana, Perú y México que se han acercado por primera vez a “mi casa” y me han escrito (en público o en privado) alentándome a seguir dignificando la ciencia. Ellos, igual que nosotros, no están faltos de Seres Sin Luz. Y en muchos casos carecen de los recursos que nosotros poseemos. Mucho ánimo y adelante.

Como si el artículo de hoy fuese una especie de “coche escoba”, haremos una recapitulación de las ideas más importantes que no debemos olvidar:

1-Hay una pandemia originada por un virus denominado SARS Cov2, popularmente conocido como coronavirus. No es una falsa noticia. Enferman y mueren personas. Millones. El virus ha sido secuenciado, fotografiado y obtenido de las muestras humanas. Este virus es bastante peor que la gripe habitual. Mata más y con más saña. Además no es estacional como la gripe, sino permanente. Ignorar o negar la pandemia no la hará desaparecer.

2-No existe ninguna conspiración mundial tras esta pandemia. Las paranoias son libres, y desafortunadamente refractarias a todo tipo de terapias y razonamientos.

3-El método científico, que nos ha traído con éxito desde mediados del siglo XVI hasta la actualidad, es la única forma conocida de salir de este atolladero biológico.

4-En el momento actual, la única manera conocida de frenar la pandemia es mediante responsabilidad personal, higiene y prevención: evitar las aglomeraciones, evitar los sitios cerrados, usar la mascarilla correctamente y lavarse las manos con asiduidad.

5-El dióxido de cloro, el aguarrás, la lejía, las pulseras magnéticas, el agua imantada, la homeopatía y otras múltiples chorradas no sirven en absoluto.

6-Las personas asintomáticas portadoras de coronavirus son contagiosas, al igual que sucede con otras muchísimas enfermedades infecciosas.

7-La mascarilla es imprescindible si estamos con otras personas o acudimos a espacios cerrados, pues frena la expansión de partículas de saliva al hablar, toser o estornudar. La necesidad de mascarillas en espacios abiertos o en situaciones de soledad es muy cuestionable, aunque las autoridades sanitarias así lo exijan.

8-Las cuatro o cinco vacunas para combatir el coronavirus que ya han salido, o van a salir, lo han hecho con demasiada precipitación para mi gusto. Normalmente se tarda entre 10 a 20 años en elaborar una vacuna segura. Es muy posible que se hayan saltado pasos importantes en este empeño. Yo, por el momento, la voy a desaconsejar a mis pacientes y a mi familia. Esto es una opinión personal basada en el “primun non nocere”.

9-Publica hoy la prensa que acaban de confirmar los científicos que las personas pueden pasar el coronavirus más de una vez. Eso significaría que la inmunidad frente al bicho es efímera (de meses), como sucede con la gripe. Una malísima noticia, aunque esperada.

10-Es muy necesario vacunarse contra la gripe y contra las demás enfermedades incluidas en los calendarios vacunales de cada país. No hacerlo pone el riesgo a tu familia y a los demás, y puede hacer regresar enfermedades ya casi erradicadas.

11-Si eres PCR negativo no te confíes. Eso sólo significa que lo eres HOY. Mañana te podrías contagiar.

12-Independientemente de tu PCR, cumple con las instrucciones de tu médico en materia de cuarentena. Los casos deben aislarse. Los contactos estrechos de un caso, también.

13-La Sanidad Pública Española, en lo que se refiere a sus profesionales, está a punto de colapsar. La Atención Primaria, en concreto, no puede más. No queremos más aplausos, ni más Premios Princesa de Asturias. Queremos más medios humanos. Y los queremos YA. ¡YAAAAAAAAA..!!!!! ¿Hay alguien ahí? Toc, toc, toc… ¡YAAAAAAAA..!

Un abrazo para todos. De los de antes de la pandemia.

Comenzaremos con un foro sobre la apertura de escuelas y colegios, ya que habéis sido miles los que lo habéis pedido. Espero la participación de padres, madres, profesores y epidemiólogos. Vosotros sabéis más que yo de ese asunto. Sacaremos conclusiones entre todos.

Juan Manuel Jiménez Muñoz.
Médico y escritor malagueño.

DESMONTANDO A LOS IMBÉCILES (PARTE 6).Aquí te presentamos el caso clínico típico, de un tío típico.

Anteriormente nos hicimos expertos en adenina, guanina, timina y citosina. Y en uracilo, coño. Y en uracilo. Y descubrimos en qué consiste la PCR para detectar cadenas de nucleótidos del coronavirus. Me cachis en la mar. A este paso vais a saber más que Miguel Bosé. Que ya es saber. Pero lo malo de saber tanto es que inmediatamente te ponen a trabajar. Cagoentó. Hala. Hoy vamos a hacer de rastreadores de casos y contactos, que es a lo que nos dedicamos en Atención Primaria, básicamente, desde que comenzó la pandemia.

CASO CLÍNICO:

<<Juanito Pérez Pérez es un cabroncete de 25 años que asistió a una fiesta privada con una docena de amigos en la que fumaron todos de la misma cachimba y compartieron vasos, botellas y otras cosas que no digo porque me cerrarían el Facebook.

Juanito Pérez vive en casa de su madre. Sus convivientes directos son: su madre Engracia, viuda de 50 años; su hermana Antonia, de 22; y su abuela Adela, de 86. Además, se dan las siguientes circunstancias: Juanito Pérez trabaja en un taller con otros siete mecánicos; y su hermana Antonia trabaja en una panadería junto a su jefa.

Pasados tres días de la fiesta, Juanito Pérez recibe la llamada de su médico: cinco asistentes al botellón tienen fiebre, dolor de garganta y tos. Se han hecho todos una PCR para el coronavirus y tres han dado positivo. Juanito no se nota nada raro. Pero se asusta. En su familia y en su taller nadie tiene síntomas tampoco. Por ahora, claro>>.

Muy bien, lector. Esto que aquí te he contado es el pan nuestro de cada día de los Centros de Salud. Unos Centros de Salud que NO ESTÁN CERRADOS al público. Unos Centros donde trabajamos MÁS QUE NUNCA. Unos Centros donde hacemos todo lo posible por rastrear e identificar los casos y los contactos del coronavirus. Unos Centros sin recursos suficientes. Unos Centros donde los miles de Juanitos Pérez que pululan por España están consiguiendo que no podamos dedicar el tiempo suficiente a los diabéticos, a los hipertensos, a los cardiópatas y a los obesos. Unos Centros dedicados, casi en su totalidad, a gestionar burocracia y a seguir la pista a estos descerebrados. Unos Centros donde se están produciendo ya agresiones al personal porque “lo primero es lo mío”. Unos Centros que algunos hijos de puta han intentado quemar con los médicos adentro, como en las provincias de Málaga y Valladolid. Unos Centros donde se convocan manifestantes por las redes sociales para “linchar a los médicos”, como en el caso de Málaga. Unos Centros donde bregamos a diario contra el coronavirus mientras tenemos que oír que el coronavirus no existe. Unos Centros donde el personal está a punto de tirar la toalla, abandonar la profesión y darle por culo al mundo. Unos Centros que hace poco recibían aplausos hipócritas fruto del miedo, no del agradecimiento. Unos Centros de Salud que… ¡huy, huy, huy! Creo que se me ha ido la olla. Discúlpeme el lector. No sé en qué estaría pensando yo. Perdón. Perdón. Perdón. Estábamos con el cabroncete de Juanito Pérez Pérez, cuyo comportamiento incívico va a poner en grave riesgo a muchas personas y va a hacer que varios enfermeros y médicos de su Centro de Salud le dediquen a él y a su familia un tiempo del que no disponen. ¡Huy, huy, huy! Perdón. Perdón otra vez. Ya se me iba la olla de nuevo. Cagoentó.

Hala. Venga. Vayamos al rastreo del caso de Juanito. Que Juanito se lo merece. Pa eso paga.

1-A Juanito Pérez le hacemos una PCR que da positiva, pero él sigue sin tener síntomas. ¿Puede ser un falso positivo? Pues sí. Pudiera ser. Son infrecuentes, pero existen. Pero con una PCR positiva siempre nos pondremos en la hipótesis peor y más frecuente: tiene virus y contagia. Así funciona la ciencia: siempre con incertidumbres. Sólo los Seres Luz tienen certezas absolutas. Los médicos, no. Por eso la ciencia mejora con el paso de los años, y el oscurantismo no. De todas formas, lo que sucede con Juanito es que nos da exactamente igual la PCR. Juanito es un contacto estrecho con tres casos confirmados (los tres amiguetes de la cachimba), y tiene que guardar cuarentena. Si no aparecen síntomas en dos semanas, y si la Sanidad estuviese colapsada, podría ser “aceptable” enviarlo de nuevo a su trabajo sin realizar otra PCR; pero lo ideal es una segunda PCR para comprobar la negativización antes de levantar la cuarentena. Igual que con Irene Montero. Recuerden el caso.

2-La PCR positiva de Juanito implica que debamos realizar la PCR, también, a todos sus contactos estrechos familiares y a los compañeros del taller. Eso hacemos. Todos dan negativos, salvo la abuela de Juanito, que además ha empezado a toser. De la abuela (PCR positiva y 86 años) hablaremos luego. La negatividad de los demás puede explicarse por las siguientes causas:2a-Son falsos negativos: en realidad tienen el virus pero la prueba no lo detecta. Eso puede suceder si el contagio ha sido muy reciente o si la carga viral es baja.

2b-Sin saberlo, todos han pasado la infección por coronavirus hace muchos meses y están protegidos por sus propias defensas.

2c-Son verdaderamente negativos. No tienen el virus, pero podrían acabar contagiándose de Juanito o de la abuela.

A todos estos casos negativos pero con ESTRECHO contacto con una caso confirmado hay que ponerlos en cuarentena dos semanas, ya que asumimos la hipótesis más desfavorable: la 2a. Conclusión: la familia en cuarentena y el taller en cuarentena. Si aparecen síntomas… reevaluar.

3-La dueña de la panadería donde trabaja la hermana de Juanito aparece muy nerviosa por el Centro de Salud exigiendo una PCR, pues se ha enterado de que una empleada suya (Antonia) tiene un hermano PCR positivo (Juanito). Esa señora no tiene síntoma alguno. ¿Qué hacer con ella? NADA DE NADA. Juanito es el caso; su hermana Antonia es un contacto estrecho; la dueña de la panadería es el contacto de un contacto. No hay que pedirle ninguna prueba todavía, ni hacerle guardar cuarentena. Tranquilizarla y explicarle que se debe vigilar. Pero… ¡ay por Dios!: una semana después la hermana de Juanito comienza con tos y fiebre. Una nueva PCR le da positiva. La jodimos. Hay que llamar a la dueña de la panadería para explicarle que ahora sí, que ahora procede una PCR. Entonces, cabreada con la Sanidad, nos dice que va a poner una denuncia por negligencia y que va a quemar el Centro de Salud con los médicos adentro. ¡Uy, perdón! Que me desvío.

4-En cuanto a la abuela de Juanito, por supuesto que falleció por neumonía. Faltaría más. La cachimba compartida de Juanito era más importante que su abuela. Cagoentó. Pero eso sí: los negacionistas dirán que falleció por su avanzada edad y por su diabetes mal controlada, y que el coronavirus es indemostrable porque no se le hizo una autopsia. Pues no. La mató su nieto.

Y ahora, una reflexión final sobre las autopsias. Si un torero muere ante su público corneado por un Miura, no necesita autopsia: murió de una cornada. Si un loco conduciendo en sentido contrario choca con tu vehículo y te mata, no necesitas autopsia: te mató un kamikaze. Y si una anciana muere de neumonía bilateral con una PCR positiva a coronavirus y con varios familiares contagiados, no necesita una autopsia: murió de coronavirus.

Más aún. Dicen los médicos “para la verdad” que apenas muere nadie por coronavirus, porque una cosa es morir DE coronavirus y otra cosa morir CON coronavirus. Si eso fuese así, si tan pocos muertos hay… ¿para qué tantos gritos y aspavientos por “la falta” de autopsias? Aunque yo, de todas formas, niego la mayor: una anciana con coronavirus no muere porque se le haya descompensado la diabetes: muere porque EL CORONAVIRUS le ha descompensado la diabetes. Y, por lo tanto, el coronavirus ES la causa de su muerte. Y su nieto, claro. El que le llevó el regalo.

¿Autopsias para aprender de los cadáveres? Háganse muchísimas. ¿Autopsias para desentrañar los mecanismos íntimos de las vasculitis desencadenadas por el coronavirus? Todas las que hagan falta. Pero a ver si dejáis ya de confundir con este tema. Señores Inquisidores: los cadáveres infecciosos son de difícil manejo, y no requieren autopsias sistemáticas para diagnosticar la causa de la muerte. Que si estuvierais en la Edad Media, seguro que seríais los primeros en condenar a la horca a quien tuviese la curiosidad (y la valentía) de estudiar un cadáver por dentro. Y os habéis puesto muy tiquismiquis.

 

Juan Manuel Jiménez Muñoz.
Médico y escritor malagueño.

DESMONTANDO A LOS IMBÉCILES (PARTE 5).Donde explicamos de que van los PCRs, con mucho rigor científico.

Como me llamo Juan Manuel Jiménez que hoy explico yo la PCR. Aunque me cueste la vida. Y es un tema muy difícil, no os vayáis a creer. Pero os aseguro que lo haré tan facilito que incluso los Seres de Luz me lo van a comprender. Y si no, que se me seque la yerbabuena.

Los cuatro productos químicos más bellos del Universo son la Adenina, la Timina, la Guanina y la Citosina. Nunca olvides sus nombres, lector: todo lo que tú eres se lo debes a esos cuatro. Tus ojos azules, tu habilidad para las matemáticas, tu nariz chata, tu voz aguda, tus dos brazos en su sitio… todo se lo debes a la adenina, a la timina, a la guanina y a la citosina. Se llaman nucleótidos, y forman las cadenas de ADN y ARN que contienen la información al completo de lo que es Miguel Bosé, de lo que fue Elizabeth Taylor, de lo que es una serpiente, de lo que es un champiñón, de lo que es una bacteria, de lo que es un oso polar, de lo que es un sauce llorón, de lo que es el virus de la gripe, de lo que es un alga marina, de lo que fue don Albert Einstein, de lo que es el algodón… y de lo que es un coronavirus.

Esos cuatro productos químicos, esos cuatro ladrillos del libro de instrucciones de la vida, son los objetos más maravillosos que ha creado Dios, o Alá, o Jehová. Lo digo para los creyentes. Para quienes no lo somos… son los más maravillosos que ha creado la Naturaleza. Nunca te olvides de ellos, lector. A partir de ahora los nombraremos por sus letras iniciales: ATGC. Y verás tú cómo me sale algún listo diciendo que se me olvidó el uracilo.

¿Cómo dan las instrucciones esas cuatro maravillas para formar un ser vivo? Fácil. Se unen en cadenas aleatorias y se leen de tres en tres. Cada grupo es una ORDEN a ejecutar. Verás qué fácil:

AGC-TTC-CGG-CTA: esa orden significa “Futura señora Encarna: fabrique usted dos piernas ahora mismo para poder caminar”.

CAA-GCT-ACC-GAT: esa orden significa “Futuro señor elefante, fabrique usted una trompa ahora mismito para poder beber y alimentarse”.

AGG-CCC-GGT-ATA: esa orden significa “Amigo Miguel Bosé, te vas a quedar calvo en tu madurez. Fuera pelo”.

TGT-TCC-CAT-CGT: esa orden significa “Señor sapo: fabrique usted un veneno en la piel para defenderse de los depredadores”.

AAG-TGC-AGG-CAG: esa orden significa “Señor olivo: fabrique usted este otoño las mejores aceitunas de Andalucía (que, por cierto, son las de Sedella y las de Canillas de Aceituno. Como todo el mundo sabe)”.

¿Ves qué fácil, lector? Pues así todo.

Hay en la Naturaleza una secuencia concreta de casi 200 nucleótidos que nos interesa muchísimo ahora. Son instrucciones precisas que podrían comenzar de esta manera: AACGTGGCATGCCGTTATGCATTTCCGGACAAT… que quiere decir lo siguiente: “eres un coronavirus cabrón que te vas a introducir en las células humanas para generar una pandemia y joder la economía”. Bueno. Chispa más o chispa menos. Pero creo que se me entiende.

El caso es que, gracias al método científico y a los avances genéticos del último siglo, tenemos lo que nunca habíamos tenido: un aparatito que lee las cadenas de nucleótidos como si fuese el periódico y, por tanto, descifra su significado. Y no sé a qué viene dudar sobre este hecho incontestable. Hace años que leemos “órdenes” del tipo: “este niño va a ser hemofílico”, o “este niño va a tener fibrosis quística”, y damos consejo prenatal a los padres. Pues con los virus, igual. Sabemos leer secuencias de nucleótidos que dicen “soy un cabrón coronavirus que me voy a introducir en las células humanas para generar una pandemia”. Y punto. Y el que no se lo crea… que se vaya a sembrar nabos a la Edad Media.

La técnica que poseemos para leer estas órdenes genéticas se denomina PCR. En el caso del coronavirus se realiza tomando muestras de la nariz y la garganta con un hisopo. Luego se manda el hisopo al laboratorio y… ¡tachaaaaán!: el resultado.

Bien. Ahora hablaré de los resultados de la PCR. Pero antes, un inciso.

Todos sabemos que cuando una bacteria o un virus nos contagia, el cuerpo reacciona produciendo DEFENSAS.

Esas defensas se llaman anticuerpos. Para simplificar las denominaremos IgM e IgG, y están presentes en la SANGRE. Quiero decir que sólo un análisis de sangre las detecta. Nada que ver con la técnica PCR. De esto no tiene duda ni Miguel Bosé.

A las pocas horas de un contagio por coronavirus aparece la IgM en sangre. Días después ya encontramos en sangre IgM e IgG. Días más tarde ya sólo nos queda la IgG. Y esta IgG, que protege de nuevas infecciones, permanece circulando incluso cuando ya no tenemos el virus. Hay pacientes que ya llevan seis meses con la IgG positiva. Curados, por supuesto. No contagiosos, por supuesto. Protegidos de nuevas infecciones, por supuesto. Pero ignoramos si esto será para siempre o sólo por un tiempo más o menos largo. No se sabe todavía.

De modo que, a modo de recapitulación, estas son las distintas posibilidades de los resultados analíticos combinados según el momento de las pruebas. Y hago referencia, ahora, a la secuencia más habitual en la infección por coronavirus. Mañana, con el ejemplo práctico de Juanito Pérez Pérez (un cabroncete de 25 años que se va de botellón) comentaremos las excepciones: los falsos positivos, los falsos negativos, la indicación de la prueba, la actuación ante los contactos de Juanito y cosas así:

a-Momento Cero: el coronavirus entra en las fosas nasales y en la garganta de Miguel Bosé. Ningún síntoma tiene, aunque ya puede contagiar a otros sólo con su respiración. No te digo nada si canta en un escenario sin saber que porta el virus. Nada de esperar a que tenga tos y estornudos para contagiar, como afirman los médicos medievalistas de la desgraciada asociación para la “verdad”. Los asintomáticos contagian. Incluso Miguel Bosé.

b-Momento 1: Bosé se encuentra un poco cansado, pierde el olfato, le duele la garganta, tiene algo de tos seca… Entonces se sospecha que pueda estar contagiado. La PCR (muestra de material viral tomada de la nariz y la garganta) es positiva, y en la analítica de sangre aparecen anticuerpos (defensas) tipo IgM. ¡Sólo IgM!

c-Momento 2: pocos días más tarde Miguel ha mejorado. La PCR sigue siendo positiva (sigue habiendo virus; sigue contagiando). En la analítica de sangre aparecen defensas de tipo IgM e IgG.

d-Momento 3: han pasado dos semanas. Miguel Bosé está casi totalmente recuperado. La PCR ya es negativa (no hay virus; ya no contagia). En la analítica de sangre, las defensas tipo IgM son casi indetectables, pero la IgG alcanza valores notables.

e-Momento 4: han pasado varios meses desde que Bosé se contagió. PCR negativa. En sangre, IgM negativa e IgG positiva (paciente sano y protegido).

Bueno. Hasta aquí la clase. No sé vosotros, pero yo me encuentro muy satisfecho con mi disertación de hoy. De hecho, creo que no se me va a secar la yerbabuena.

Cagoentó y hasta el siguiente capitulo. Nos espera el tal Juanito Pérez Pérez, que va a volver loco a su médico de cabecera por asistir a un botellón. Veréis qué risa.

Ah. Se me olvidaba. Mucho cuidado si recibís un archivo cerrado diciendo que son entradas gratis para un concierto de Miguel Bosé. No lo abráis. Podrían ser entradas gratis para un concierto de Miguel Bosé.

Juan Manuel Jiménez Muñoz.
Médico y escritor malagueño.

DESMONTANDO A LOS IMBÉCILES (PARTE 4).Con mucho humor.

¿Qué le dice un moribundo a su familia mientras yace doliente en su casa? <<Por Dios, por Dios, por Dios, no llaméis a ningún médico. ¡Quiero morir de muerte natural!>>.

Hala. Ese chiste de médicos, escrito por Jardiel Poncela, se lo regalo a los vendedores de crecepelo. A ver si alguno es capaz de devolverme otro chiste sobre los Seres de Luz. Verás que no. Porque la falta de humor, junto a la falta de autocrítica y la falta de vergüenza, es otra característica de los seres acientíficos: jamás harán bromas de algo que tenga que ver con sus sagradas paranoias. Porque el humor y la risa, como bien decía el malvado fraile ciego de “El nombre de la rosa”, es el enemigo más acérrimo de la autoridad.

Un Ser de Luz me dijo ayer en un mensaje privado: <<ojalá se te muera lo que más te importa>>. Y luego, tras irradiar varios halos de energía positiva, ascendió a los cielos en carros de fuego. Como el profeta Elías. Palabrita del Niño Jesús.

Otro energúmeno me llamó <<genocida>>, y me amenazó <<con un juicio>>. Supongo que lo habrá programado en la ciudad alemana de Núremberg. En fin. Espero que la sesión judicial no caiga en martes ni en jueves, que doblo en el Centro de Salud.

Tengo otro seguidor de Facebook que propone rescatar una antigua tradición del pueblo maya: la de sacrificar a sus líderes en tiempos de pandemia. A ese le he dicho que sí.

Otro tipo dice que no se pone mascarilla porque a él no lo controla nadie. Qué cabezas. El mismo tipo que lleva un GPS en el móvil. El mismo que cuando se salta un radar le llegan las multas a casa. El mismo que le ha dado a <<aceptar>> a todas las normas de Twitter, de WassApp y Facebook. Incluso a las normas de la linterna del móvil. Por Dios, por Dios, por Dios. Qué daño está haciendo la ayahuasca.

En fin. Son cositas del querer. Y no poder. Pero ha merecido la pena: incluso Miguel Bosé, el muy bandido, dice ahora que <<el coronavirus existe y ha matado a mucha gente>>. Qué diablillo.

En otro orden de cosas, tengo un escéptico razonable que, sin ser médico ni sanitario, me dijo por privado lo siguiente:

<<Doctor, ¿no sería posible introducir el coronavirus a dosis bajas en el cuerpo de muchas personas para crear defensas contra la enfermedad?>>.

Brillante. Y lo digo absolutamente en serio, sin pizca alguna de maldad. Justo esa fue la idea del inglés Edward Jenner en el siglo XVIII cuando creó la primera vacuna del mundo: la de la viruela, la que acabó por erradicar la enfermedad. Así que felicité a mi contertulio por su idea. Una idea que él desconocía que funcionaba, y yo me pregunté la razón de su ignorancia: <<¿qué coño ha pasado aquí para que la gente no sepa quién fue Jenner?>>.

Para encontrar la respuesta realicé un experimento concreto, que es la base del método científico. Metí en Google las primeras 4 letras de mi querido científico: JENN… Y entonces, para mi asombro, el buscador me lanzó las siguientes propuestas, que se basan en las búsquedas más frecuentes en la red: Jennifer López, Jennifer López edad, Jennifer Aniston, Jennifer Aniston edad, Jennifer Aniston and Brad Pitt, Jennifer Aniston hijos, Jennifer Grey, Jennifer Garner, Jennifer Beals, Jennifer Lawrence… y así hasta el infinito y más allá. Luego me enteré de que todas ellas son famosas o famosillas. De cantar, de bailar, de follar o de actuar, dicho sea con todos mis respetos. Pero mi histórico científico, sin aparecer. Jenner, el hombre que tal vez haya salvado más vidas en la Historia Mundial, ha sido relegado a los últimos puestos de Internet. Horroroso, lector. Horroroso. Pa habernos matao. No digo más.

Y en esa empanada cultural en que vivimos tengo otro escéptico en mi muro que ya me está tocando los cojones. Afirma ser diseñador gráfico digital o cosa así, pero habla y pontifica sobre el coronavirus como un catedrático de virología. Es lo normal en estos tiempos que corren. Eso sí: ningún diseñador digital se metería en el despacho de un arquitecto a corregirle los planos. Ningún diseñador se metería en un bufete de abogados para explicar a los picapleitos cómo se redacta un recurso de casación ante el Tribunal Supremo. Ningún diseñador se metería en un taller de automóviles para explicar a un mecánico cómo arreglar un embrague. Pero eso sí: sobre los aminoácidos que componen las espículas del coronavirus no hay diseñador, abogado, arquitecto, criador de reses bravas, cantante, chamarilero, catador de vinos o sexador de pollos que no tenga algo que decir. Cagoentó.

Lo último de ese portento en ciencia infusa (el diseñador) es lo siguiente:

<<yo no conozco ningún caso de paciente asintomático que vaya contagiando el virus>>.

Pero vamos a ver, alma de cántaro. ¿Tú qué coño vas a conocer? ¿No eres diseñador gráfico digital o cosa así? ¿Tú tienes acceso a las historias clínicas de los pacientes? ¿Tú conoces personalmente a los 7000 millones de habitantes del planeta? ¿Tú te dedicas a rastrear los contactos de los casos? ¿Tú asistes a sesiones clínicas? ¿Tú has participado en metaanálisis de los mejores estudios publicados? Cagoentóloquesemenea con el diseñador. Es como si yo le dijese: <<yo no conozco ninguna impresora láser que funcione>>. ¿Qué coño sé yo de impresoras láseres? Horroroso, lector. Horroroso. Pa habernos matao. Este es el nivel, Maribel.

Y tengo otro negacionista que me exige (¡me exige!) haber realizado YO, PERSONALMENTE, experimentos con el coronavirus antes de hablar sobre el bicho. Y ahí me tocó la moral. Porque lleva toda la razón el susodicho tertuliano. Y mira que intenté experimentar. Lo que pasa es que el microscopio electrónico no me cabía en la cocina, y tuvimos que ocupar un trozo del dormitorio de matrimonio, y mi mujer se puso como una fiera al ver el primer recibo de la luz.

Y por último: me llegan reiteradas noticias acerca de un bulo muy extendido por los WassApp. Dicen que no soy médico, y que mi número de colegiado es falso. Claro. Les estoy zurrando de lo lindo y sólo tienen el recurso de lo fácil: engañar para engañarse. Pero os vais a morder las uñas de rabia cuando sepáis que soy hijo de padres campesinos, y que estudié con becas en la enseñanza pública. Hice Medicina en Málaga con matrícula de honor. Me colegié con el número 4787. Hice mi residencia en el Hospital Carlos Haya de Málaga tras superar el MIR. Obtuve mi plaza en propiedad tras unas Oposiciones Autonómicas en las que quedé en el puesto número 10 sobre más de siete mil opositores. He trabajado en las Urgencias de Pediatría del Hospital Materno Infantil de Málaga. He sido director del Centro de Salud Jesús Cautivo y del Centro de Salud Capuchinos, ambos de Málaga. Y he sido, durante 9 años, Director Médico del Distrito Sanitario Málaga. Y sigo cogiendo aceitunas cuando encarta, y escardando cebollinos si hace falta. Y sigo escribiendo novelas. Y desenmascarando imbéciles. Así que no cantéis victoria con mi vida: soy médico. Cazurro de pueblo, sí. Pero médico. Más de campo que una bellota, sí. Pero médico. Y diré que soy médico de la especialidad más completa y humanista que existe en la actualidad: la medicina general o de familia, que me permite, por ejemplo, realizar estos ejercicios de educación sanitaria sin apenas despeinarme.

¿Cómo dices, lector? ¿Que soy vanidoso, soberbio, egocéntrico y narcisista? Pues claro. Porque puedo. Y de todas formas, nada original me aportas que no me hayan diagnosticado ya las dos personas que mejor conocen lo que tengo en la cabeza: mi psiquiatra y mi peluquero.

Bueno. Y a todo esto acabo de recordar que prometí hablar hoy de la PCR. Pero mira tú por dónde me he enredado en otras cosas. Hala. Me voy a tomar mi dosis semanal de dióxido de cloro para irradiar más luz. Lo suelo mezclar con infusión de ayahuasca y veneno de sapo bufo.

En el próximo capitulo, si la ayahuasca me inspira y el sapo no se me muere, tendremos la traca final de la PCR. Si te la pierdes… no sabes lo que te pierdes.

Cagoentó.

Juan Manuel Jiménez Muñoz.
Médico y escritor malagueño.

DESMONTANDO A LOS IMBÉCILES (PARTE 3).Te explicamos la importancia de la mascarilla y de la idiotez de los bebelejías.

Seguimos hoy desenmascarando a los medievalistas, a los Seres de Luz, a los expertos en Constelaciones, a los adoradores de OVNIS, a los bebelejías y a los vendedores de pócimas. Hoy toca hablar de mascarillas y de portadores asintomáticos. Entremos en materia.
1-¿Funcionan realmente los crecepelos?
No. Ningún crecepelo funciona.
2-Y ¿por qué sabemos con seguridad que no funciona ninguno?
Porque si funcionase alguno, Julio Iglesias no estaría calvo. Por no hablar de los dermatólogos.
3-¿Funciona el dióxido de cloro y otras gilipolleces contra el coronavirus?
No. Ninguna gilipollez funciona.
4-Y ¿por qué sabemos con seguridad que no funciona ninguna?
Porque si funcionase alguna no habría muerto de coronavirus el Gobernador de Caracas, ni Bolsonaro habría enfermado en Brasil, ni el Presidente de Estados Unidos llevaría mascarilla, ni Irene Montero habría necesitado aislamiento, ni en Irán habría enfermado por coronavirus el Gobierno al completo, ni el primer ministro de la Gran Bretaña hubiese estado al borde de la muerte.
5-Entonces… ¿no hay ninguna planta que cure el coronavirus?
Sí. La Planta de Infecciosos de tu hospital de referencia. Y no siempre.
6-¿Enferman todas las personas que cogen el coronavirus?
No. Un porcentaje nada desdeñable son portadores ASINTOMÁTICOS. Eso quiere decir que tienen el virus conviviendo amigablemente con él en la garganta, pero sin causarle síntoma alguno.
7-Entonces… ¿los portadores asintomáticos del coronavirus son personas sanas?
Sí. Son sanas en el sentido de que no están enfermas (no tienen fiebre, no les duele la garganta, no tosen, no han perdido el olfato, no se encuentran cansadas, no tienen diarrea…). Pero lanzan coronavirus al aire cuando respiran, y esos coronavirus pueden contagiar a los demás.
8-¿Está usted seguro, doctor? ¿Personas sanas contagiando? ¿Personas sin síntomas esparciendo microbios a los demás? ¿Cómo es eso posible, si la Asociación de Médicos por la Verdad (AMPV) dice lo contrario, que los asintomáticos no contagian?
La AMPV, también conocida como Asociación Medievalista de Paranoicos Videntes, dice esas cosas porque faltaron a clase el día que explicaron las pandemias en la Facultad de Medicina. Hay múltiples ejemplos de personas asintomáticas pero difusoras de gérmenes. El más conocido es el caso del meningococo, que ocasiona la meningitis meningocócica. El meningococo (A, B, C…) convive alegremente en la garganta de muchas personas sin síntomas, pero estas personas sanas lo esparcen al respirar y se contagian otros, que enferman gravemente.
9-Usted exagera, doctor. La meningitis será una excepción, ¿verdad?
En absoluto. Hay multitud de ejemplos de transmisión de gérmenes desde personas sanas-asintomáticas hacia otros desgraciados. La mononucleosis infecciosa o “enfermedad del beso” se contagia desde portadores asintomáticos a partir de la saliva. Hay personas que expulsan bacterias de la tuberculosis al respirar sin tener síntoma alguno. La varicela se contagia desde personas todavía sanas a través de la respiración, antes de que les salgan vesículas en la piel. Multitud de personas son VIH positivas sin tener síntomas de SIDA, pero infectan a otros mediante relaciones sexuales sin preservativos Y me voy a callar porque me llevan los demonios.
10-¿Las mascarillas protegen de los contagios por coronavirus?
Por supuesto. Nadie puede saber si ÉL está sano pero es portador asintomático del coronavirus y lo puede contagiar a otros (esa sería la “duda altruista”). Y nadie puede saber si está hablando con OTRO sano pero que esparce coronavirus (esa sería la “duda egoísta”). Ambas dudas son legítimas. Y por ambas hay que llevar mascarilla.
11-Pero doctor, dicen que usted defendió en los primeros días de la pandemia que el uso de las mascarillas era procedente para el personal sanitario pero improcedente para la población general. ¿Es eso cierto?
En efecto. Eso escribí. Y me equivoqué. Y las razones de mi equivocación fueron las mismas que equivocaron al mundo científico: se sabía muchísimo menos que hoy de los mecanismos de contagio del coronavirus, pues era (y es) una enfermedad nueva. Con la evidencia actual he cambiado de opinión. Por cierto: cambiar de opinión cuando te demuestran que estás equivocado forma parte del método científico. Por eso mismo jamás verás a un negacionista mudar de opinión ante nuevas evidencias. Esa es la diferencia entre la cordura y la paranoia, como se explicó en el primer artículo de esta serie.
12-¿Siempre hay que llevar la mascarilla puesta?
Como norma general, sí. Pero resulta lógico pensar que es absurdo llevarla si te desplazas solo en tu coche, o si te acompañan en tu vehículo las mismas personas con las que convives habitualmente, o si estás de solitaria excursión al aire libre en una sierra perdida. Esas cosas son de sentido común, independientemente de que las autoridades sean más o menos estrictas a la hora de multar. Lo que es un pecado mortal es acudir a eventos multitudinarios, a edificios cerrados, a discotecas, a botellones, a manifestaciones, a reuniones con extraños o a reuniones con amigos sin portar TODOS las mascarillas. Así de fácil. Y cuando digo “portar” no me refiero en el codo ni en la barbilla. So listo.
13-Pero doctor… ¿no me envenenaré con mi anhídrido carbónico al respirar mucho rato en la mascarilla?
No. No te envenenarás. Hasta ahora, que yo sepa, nunca se dio el caso de un cirujano o de un anestesista envenenado por la mascarilla. Lo que envenena es el dióxido de cloro vendido por Internet, y la multitud de charlatanes que pululan por las redes. Cuídate de ellos más que de las mascarillas.
Hala. En próximo capitulo, la traca final de la PCR. Si te la pierdes… no sabes lo que te pierdes.
Cagoentó.
Juan Manuel Jimenez Muñoz.
Médico y escritor malagueño.

 

DESMONTANDO A LOS IMBÉCILES (PARTE 2).En la que hablamos de Seres de Luz y vendedores de milagros.

Vamos a seguir con la serie dedicada a la ciencia y al coronavirus. Continuamos para bingo. Nos divertiremos juntos y aprenderemos bastante. Palabrita del Niño Jesús. Ah. Y desenmascararemos a los medievalistas, a los Seres de Luz y a los vendedores de crecepelo. Cagoentó.
1-¿Quién fue Guillermo de Ockham?
Fue un filósofo europeo del siglo XIV que hizo una aportación crucial al pensamiento científico: postuló que la Naturaleza sigue siempre los caminos más sencillos, y que por eso, cuando para una pregunta existan varias respuestas posibles, la verdadera será la más sencilla de todas. A esto se le conoce como “la navaja de Ockham”, y ha sido un arma poderosísima para que la ciencia avance hasta los niveles actuales.
2-Si la rama de un árbol se cae y mata a un niño, ¿Cuál de estas tres hipótesis, aplicando la navaja de Ockham, será probablemente la verdadera causa de la desgracia?
a-La rama estaba podrida y se partió por casualidad.
b-Un espía ruso, persiguiendo a otro espía americano, saltaba de árbol en árbol y rompió una rama podrida.
c-Un rayo láser procedente de Ganímedes vino a parar a la rama podrida del árbol, sobre la cual, además, se peleaban dos espías: uno ruso y otro norteamericano.
3-Aplicando ahora la navaja de Ockham diga el lector cuál de las tres siguientes hipótesis es la más plausible sobre el origen de la pandemia del coronavirus:
a-Un coronavirus de la fauna salvaje ha saltado de forma natural a la especie humana.
b-Todas las potencias mundiales se han puesto de acuerdo para crear un virus mortal, y luego se han compinchado con la industria farmacéutica para meterlo en la vacuna de la gripe y diseminarlo por el mundo.
c-George Soros, Bill Gates, los rusos, los chinos y los americanos han creado unas radiaciones electromagnéticas del 5G que están matando a la gente. Para disimular su crimen, también han creado un coronavirus que han introducido en la vacuna de la gripe, y luego han ocultado que el dióxido de cloro es el remedio definitivo para las radiaciones electromagnéticas y para el coronavirus. Todo ello con la ayuda de la casi totalidad de los médicos del mundo, en una operación planificada de genocidio tras la cual sólo quedarían vivos Bill Gates, George Soros y Jordi Hurtado.
4-Además de la navaja de Ockham ¿disponemos de más evidencias sobre el origen viral de la pandemia de coronavirus?
Sí. Tenemos millones de fotos del coronavirus realizadas con microscopios electrónicos y de barrido. Se han fotografiado sus espículas. Sabemos, incluso, qué cadenas de aminoácidos de las espículas se unen a las células humanas para penetrar en su interior. Se ha secuenciado el genoma del coronavirus. Y además, aunque parezca una perogrullada, todos los fallecidos por coronavirus eran portadores del coronavirus. Y los fallecidos por causas diferentes no tenían coronavirus. A eso lo llamamos relación causal. Que no casual.
5-¿Cómo se contagia el coronavirus entre los humanos?
Respirando los coronavirus que otros expulsan con la respiración, la tos o los estornudos. O llevándonos las manos a la boca tras tocar con ellas objetos o superficies donde vivan coronavirus expulsados por los demás.
6-¿Cómo nos podemos proteger del coronavirus?
Evitando las formas de contagio arriba descritas. Esto es: manteniendo una distancia social con otras personas, portando mascarillas y lavándonos frecuentemente las manos.
7-¿Es cierto, como afirman los Seres de Luz, que las mascarillas no protegen de las infecciones?
Quien opine eso, para ser consecuente con su afirmación, debería exigir al cirujano que lo va a operar de apendicitis que no se ponga la mascarilla durante el acto quirúrgico, y que le lance saliva al peritoneo. A ver qué pasa.
8-¿Son útiles las vacunas que tenemos en la actualidad para prevenir muchísimas enfermedades?
Sí. Son útiles e imprescindibles. Y eso lo sabemos por muchas razones científicas, aunque me quedo con una razón personal: en 2015, en Olot (España), murió un niño de 6 años por difteria. Gracias a las vacunas llevábamos 32 años sin un puto caso de difteria. Pero el movimiento antivacunas la jodió. Los padres de ese niño eran antivacunas, y la criatura estaba sin vacunar, lo cual no impidió que en el último momento acudieran al hospital buscando un remedio urgentísimo cuando el niño se moría. Ni impidió, tampoco, que, tras el entierro, declararan los padres a la prensa “que habían vivido engañados”. Es lo que tiene cuando te duele en lo tuyo: que se te acaban las tonterías.
9-¿Qué podemos decir de las nuevas vacunas contra el coronavirus? ¿Servirán? ¿Serán seguras?
No lo sabemos. De entrada, fabricar una vacuna útil y segura supone de 10 a 20 años de durísimo trabajo investigador. Las vacunas del coronavirus saldrán en un año o en dos, por lo que resulta evidente que los fabricantes se han saltado pasos cruciales. Además, el método científico supone compartir entre colegas los datos de la experimentación. En este caso ha primado el secretismo para hacerse con el mercado mundial y mantener la patente. Por eso, el abajo firmante no será el primero en vacunarse, ni aconsejará a sus pacientes que lo hagan. Hasta que todos los concejales de urbanismo de España hayan probado en sus carnes la vacuna del coronavirus… ni loco me pincho yo ese mejunje. Y lo dice un médico que se vacuna anualmente de la gripe junto a toda su familia, y un intachable defensor del calendario vacunal. Pero como dice el primer principio de la ética, “Primum non nocere”: lo primero, no hacer daño. Y eso es lo que pienso aplicar en este caso concreto.
Seguiremos con más preguntas y respuestas sobre la ciencia y el coronavirus. Si te lo pierdes… no sabes lo que te pierdes.
Cagoentó.
Juan Manuel Jimenez Muñoz.
Médico y escritor malagueño.

.

LA SOCIEDAD SI EXISTE.

Cuentan las crónicas que en 1987 en una entrevista le preguntaron a Margaret Thatcher quien era la sociedad a lo que esta respondió “no existe tal cosa, tan solo individuos, hombres y mujeres´´.

Han pasado 30 años desde que la Dama de Hierro dejo Downing Street y desde entonces sus palabras no han dejado de lacerar cada lucha por un bien común a través de la individualidad, una individualidad perversa, que muestra orgullosa los egoísmos de cada persona pero que oculta los miedos que provocan ese egoísmo, miedos que el sistema económico en el que vivimos, descendiente directo del Thatcherismo sabe multiplicar exponencialmente en cada crisis.

Han pasado más de 5 meses desde que la Ministra de Trabajo Yolanda Diaz mandaba su “guía para empresas ante el coronavirus´´ era 4 de Marzo y el día siguiente los empresarios exigían rectificación, los sindicatos mostraban su pesar por no ser preguntados y la Ministra se veía obligada a señalar que era una “compilación´´ y no una guía, desde Moncloa se tragaba con las exigencias empresariales, la economía por encima de la salud, el Thatcherismo volvía a cobrarse una victoria aplastante ante el bien colectivo, 10 días después la situación del país era catastrófica y obligaba a decretar el Estado de Alarma en todo el país.

Una pandemia comenzaba a extenderse por todo el globo siendo España de los primeros países que la sufriría, años de destrucción de políticas públicas sanitarias, destrucción industrial y por lo tanto tejido social o convertir en un negocio el bienestar social de nuestros mayores en sus últimos años de vida creaban un coctel perfecto para que el virus hiciese estragos entre la población.

España veía impotente como posiblemente la mejor generación que ha parido este país moría a miles sin recibir la atención sanitaria que habían construido durante décadas, la trituradora neoliberal capitaneada por Esperanza Aguirre, la alumna más aventajada de la nacida en las East Mindlands había demolido hasta su cimientos el sistema de salud , recortando personal , camas y medios en nombre de los beneficios empresariales, su modelo fue exportado a cada rincón del país, cuando el virus llegó arrasó a su paso residencias y hospitales, el sistema se derrumbó, nadie lo reconocerá pero el sistema económico se vino abajo como un castillo de naipes, el capitalismo , el neoliberalismo, nuestro modo de vida era el caldo de cultivo perfecto del virus solo había una forma de pararlo, TRABAJAR COMO UN EQUIPO, las trabajadoras del sistema público sanitario serian nuestro pilar alrededor de ellas cajeras, transportistas y un grupo ingente de almas a las que se denominó “esenciales´´ hacían que el mundo siguiese girando, el resto solo teníamos que cumplir con una serie de indicaciones que si bien eran la antítesis de nuestro modo de vida no dejábamos de realizar la parte más fácil del trabajo, quedarnos en casa, LA SOCIEDAD EXISTIA, OTRO MODELO ERA POSIBLE Y ERA MUCHO MEJOR, el Gobierno adecuaba la figura del ERTE para que el trabajador no fuese despedido, se aprobaba un ingreso mínimo vital, se apostaba por el trabajo desde casa, se evitarían los desahucios y se pospondrían los pagos, estas eran solo un ejemplo de las medidas comunitarias llevadas a cabo en lo que se llamaría “escudo social´´

Toda acción implica una reacción de igual magnitud pero en sentido opuesto, esa reacción se manifestaría con toda su crudeza cuanto más éxito tenía el nuevo modelo y conseguía parar la sangría de víctimas, el individualismo disfrazado de libertad se manifestaba en las calles con un lenguaje de odio y la implantación del miedo, ese miedo hacía que el autónomo, el pequeño comerciante que eran los que más daños habían sufrido, y buena parte de la sociedad trabajadora que estaba en ERTE mirase a la economía otra vez cuando la salud aún no se había protegido en su totalidad, los medios dejaban de lado las recomendaciones sanitarias para dar voz a los empresarios y los adalides del sistema neoliberal que exigían volver a tener el control, su soberbia les hacía pensar que el virus esta vez se doblegaría ante nuestro sistema, se obviaron fases de control comunitarias, se cuestionaron las medidas sociales que frenaron al virus, se puso en funcionamiento la maquinaria empresarial , otra vez el interés de unos pocos individuos por encima del interés general.

La soberbia y la mezquindad han sido las puntas de lanza del sistema, se ha protegido el sistema privado de salud y blindado sus medios cuando necesitábamos cada cama, cada UCI y cada profesional, se oculta y protege la acción de empresas privadas en las residencias de ancianos y se amenaza con surtirlas de un reguero de dinero público que se niega para rastreadores, se vende la acción público-privada como el ejemplo a seguir cuando si algo se ha demostrado es la absoluta incompetencia de este modelo en medio de una pandemia, se adivina un nuevo desastre en la educación , la cual ha sufrido los mismos destrozos en su sistema público que la sanidad, el despropósito continua.

16 de Agosto, el metro de Madrid sigue lleno, las más de 1000 inspecciones laborales en el campo de la Ministra de Trabajo nos hacen ver la realidad de las condiciones de semiesclavitud del campo, los infectados vuelen a sumar por miles cada día, se abren plazas de toros abarrotadas como uno de los símbolos (no el único hay muchos más) de como de estúpidos nos hace nuestra egoísta individualidad, se toma la decisión de cerrar discotecas pues la realidad nos vuelve a abofetear, nuestro sistema vuelve a ser el caldo de cultivo perfecto del virus, solo una diferencia con los meses anteriores , ahora se pretende culpabilizar la individualidad de décadas para proteger la economía, una pirueta casi cómica de nuestro destino como país, querer hacer ver que el sistema económico no tiene culpa ninguna de las muertes causadas, que es ajeno a su vástago más cruel, la individualidad por encima de lo común , “no existe tal cosa, solo el individuo, hombres y mujeres´´ dijo Margaret Thatcher cuando se la interpelo por la sociedad , ¿no querrán ahora sus discípulos llevarla la contraria, verdad?.

33 años después existe una posibilidad de crear una sociedad con un nuevo tejido social, que blinde lo público, que invierta en bienestar social y un modelo económico mucho más igualitario, protector del medio ambiente y defensor de las libertades, si , pero de aquellas que fortalezcan al colectivo, a la clase trabajadora, a una sociedad que nunca dejó de existir y que muestra la cara de la que mas orgullosos nos deberíamos sentir.

JOE VUELTO (Palencia)

DESMONTANDO A LOS IMBÉCILES (Parte 1).En la que hablamos sobre paranoicos.

Publicaré en los próximos días una serie de artículos sobre la ciencia en general y el coronavirus en particular. Muy aconsejables desde el punto de vista de la Salud Pública y de la Salud Mental. Te invito a seguir visitando mi muro. Lo vamos a pasar genial. Y aprenderemos ciencia, que es de lo que se trata.

1-¿Qué es un paranoico?

Un paranoico es una persona que se comporta con normalidad en todos los aspectos de su vida salvo en uno: en su llamada “idea delirante paranoica”. La idea delirante paranoica se caracteriza por ser una construcción objetivamente falsa pero inasequible a cualquier tipo de razonamiento lógico. Es una idea enquistada, irracional, casi siempre de persecución o daño, y no responde a ninguno de los siguientes tratamientos: psicoterapia, discusión razonada, pruebas palpables o fármacos.

2-¿Están “locos” los paranoicos?

En absoluto. La paranoia nada tiene que ver con la esquizofrenia. Salvo en lo que se refiere a sus ideas delirantes, los paranoicos se comportan con normalidad en el resto de sus vidas. Pueden ser estupendos pintores, agricultores, pescadores, maestros, abogados o tenderos. Incluso pueden cantar magníficamente “Seré tu amante bandido”.

3-Si a un paranoico convencido de que la Tierra es plana se le muestran fotografías de la Tierra tomadas desde el espacio, ¿admitirá que la Tierra es esférica?

Jamás de los jamases.

4-Si a un paranoico convencido de que el coronavirus no existe se le muestran fotografías del coronavirus tomadas con microscopio electrónico hasta el detalle de las espículas, ¿admitirá que existe el coronavirus?

Jamás de los jamases.

5-Si a un paranoico convencido de que las vacunas de la gripe han sido la causa de la infección por coronavirus se le muestran pruebas palpables de la inocuidad de la vacuna de la gripe, ¿admitirá su error?

Jamás de los jamases.

6-¿Es el dióxido de cloro un producto venenoso?

Sí. El dióxido de cloro sólo está autorizado para la desinfección de depósitos de agua y otras situaciones parecidas. Su consumo directo en humanos está prohibido, aunque su toxicidad parece leve.

7-¿Hay pruebas científicas de que el dióxido de cloro sirva para curar el coronavirus?

Ninguna. No existen ensayos clínicos a doble ciego, ni estudios multicéntricos, ni metaanálisis, ni revisiones bibliográficas por pares, que son las fuentes actuales del conocimiento científico-médico.

8-Entonces…¿Qué evidencias aportan quienes defienden al dióxido de cloro como la panacea contra el cáncer, la calvicie, la impotencia, el mal de amores, los infartos y el coronavirus?

Las evidencias que aportan son de dos tipos:

a-“yo conozco a una amiga de una cuñada de una prima de mi novia que tenía un cáncer incurable, y se curó con dióxido de cloro”.

b-“hay un señor muy listo en Alemania, o en Argentina, que ha experimentado en su casa con dióxido de cloro y dice que ha curado a centenares”.

9-Quienes defienden que el dióxido de cloro es el tratamiento perfecto para todo, pero que los políticos y los médicos, compinchados a millones, nos negamos a administrarlo para causar un genocidio… ¿son paranoicos?

Sí. Y, como dije antes, no existe tratamiento para su paranoia. Aunque estamos ensayando el dióxido de cloro.

10-¿Todos los que defienden estas gilipolleces son paranoicos?

No. Algunos, los cabecillas, los peores, son simples charlatanes de feria: vendedores de crecepelo que se aprovechan de la paranoia de los demás para hacer negocio con lo suyo. El caso más paradigmático de charlatán de feria en España es el agricultor Josep Pamiés, vendedor de terapias alternativas y plantas medicinales, que dice que no existe la pandemia o que, de existir, se curaría con abrazos y con dióxido de cloro.

11-Y… ¿por qué sabemos que las terapias alternativas de Pamiés (y en particular la terapia con abrazos y con dióxido de cloro) no curan?

Lo sabemos porque este jeta de Pamiés tuvo un infarto de miocardio en 2019, y no dudó ni un segundo en ponerse en manos de los médicos, ingresarse en una UCI y tratarse la isquemia cardíaca con betabloqueantes, antiarrítmicos y una endoprótesis coronaria conocida como stent. Nada de dióxido de cloro. Nada de besos y abrazos. Nada de las plantas medicinales que vende por Internet. Una UCI y la última tecnología. En otras palabras: la única planta que cura los infartos es la Planta de Cardiología. No las plantas de Pamiés.

12-¿Qué es la AMPV?

Es la autodenominada “Asociación de Médicos por la Verdad”, también conocida desde ahora como “Asociación Medievalista de Paranoicos Videntes”.

13-¿Cuáles son las funciones de la AMPV?

Básicamente cinco (y por el culo se la hinco): hacer chistes con la pandemia denominándola plandemia; confundir a los incautos con teorías de la conspiración; autoalimentar las paranoias propias; vender libros de autoyuda y expandir el coronavirus gracias a consejos tan brillantes como evitar las mascarillas e ingerir dióxido de cloro.

14-¿Todo lo que dicen los médicos de la AMPV es irracional o paranoico?

A esta pregunta, y a muchas más, responderé próximamente. Es tarde ya, y tengo que tomar dióxido de cloro para que me suba las defensas.

Cagoentó.

Juan Manuel Jimenez Muñoz.
Médico y escritor malagueño.

 

Charles Dickens (Libros en PDF)

Charles John Huffam Dickens (Landport, Portsmouth, Inglaterra, 7 de febrero de 1812-Gads Hill Place, 9 de junio de 1870) fue un escritor y novelista británico, uno de los más conocidos de la literatura universal, y el más sobresaliente de la era victoriana. Fue maestro del género narrativo, al que imprimió ciertas dosis de humor e ironía, practicando a la vez una aguda crítica social. En su obra destacan las descripciones de gente y lugares, tanto reales como imaginarios. Utilizó en ocasiones el seudónimo Boz.

Sus novelas y relatos cortos gozaron de gran popularidad durante su vida, y aún hoy se editan y adaptan para el cine habitualmente. Dickens escribió novelas por entregas, el formato que usó en aquella época fue la ficción, por la sencilla razón de que no todo el mundo poseía los recursos económicos necesarios para comprar un libro. Cada nueva entrega de sus historias era esperada con gran entusiasmo por sus lectores, nacionales e internacionales. Fue y sigue siendo admirado como una influyente personalidad literaria por escritores de todo el mundo.

Biografía de Charles Dickens

1) Cuento de Navidad
2) Grandes esperanzas
3) Oliver Twist
4) David Copperfield
5) Historia de dos ciudades